Top » Catalog » SNPs » A26337

$18.00

A26337
[A26337]

A26337
hg38 Position: ChrY:12046660..12046660
Ancestral: G
Derived: T
Reference: Nasser Alanazi (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A26337_F CATTTCCAAGTCAATCCTAAACG
Reverse Primer: A26337_R CAAAAACTTTCTCCCATTCTGTG
Reviews

Customers who bought this product also purchased
FGC32305
FGC32305
FGC29860
FGC29860
FTA13328
FTA13328
FGC29863
FGC29863
ZS2043
ZS2043
ZS2017
ZS2017
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies