Top » Catalog » SNPs » FT151463

$18.00

FT151463
[FT151463]

FT151463
hg38 Position: ChrY:19082206..19082206
Ancestral: G
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: Below L22 > L813 > Y5483 > Y36599
Forward Primer: FT151463_F CAAAAGTCCGACCACACCTAC
Reverse Primer: FT151463_R ATAAGTTATGCTCACCAATGCG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
BY78544
BY78544
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies