Top » Catalog » SNPs » Z17296

$18.00

Z17296
[Z17296]

Z17296
hg38 Position: ChrY:8104092..8104092
Ancestral: C
Derived: T
Reference: G. Magoon et al.
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a1a1
Comments: downstream of L513 > L193
Forward Primer: Z17296_F AAAAGGAGAAAGTCAAATTTTCTCTC
Reverse Primer: Z17296_R CAATCCTGTTACAGGTCCGG
Reviews

Customers who bought this product also purchased
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Z17299
Z17299
DF21
DF21
A7
A7
Z17294
Z17294
Z253
Z253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies