Top » Catalog » SNPs » Z17296

$18.00

Z17296
[Z17296]

Z17296
hg38 Position: ChrY:8104092..8104092
Ancestral: C
Derived: T
Reference: G. Magoon et al.
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a1a1
Comments: downstream of L513 > L193
Forward Primer: Z17296_F AAAAGGAGAAAGTCAAATTTTCTCTC
Reverse Primer: Z17296_R CAATCCTGTTACAGGTCCGG
Reviews

Customers who bought this product also purchased
DF21
DF21
A7
A7
Z17294
Z17294
Z253
Z253
S5668
S5668
A8
A8
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies