Top » Catalog » SNPs » BY39364

$18.00

BY39364
[BY39364]

BY39364
hg38 Position: ChrY:21411703..21411703
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below BY39361
Forward Primer: BY39364_F AACATAATTTGAAGGCTGGGC
Reverse Primer: BY39364_R GGTAGCAAATTTGGGAAAAAATAAC
Reviews

Customers who bought this product also purchased
A159
A159
BY16028
BY16028
A9005
A9005
BY3863
BY3863
A195
A195
FT43021
FT43021
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies