Top » Catalog » SNPs » BY39364

$18.00

BY39364
[BY39364]

BY39364
hg38 Position: ChrY:21411703..21411703
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below BY39361
Forward Primer: BY39364_F AACATAATTTGAAGGCTGGGC
Reverse Primer: BY39364_R GGTAGCAAATTTGGGAAAAAATAAC
Reviews

Customers who bought this product also purchased
S1121
S1121
Z16521
Z16521
BY39361
BY39361
A541
A541
FGC29280
FGC29280
BY39363
BY39363
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies