Top » Catalog » SNPs » BY39364

$18.00

BY39364
[BY39364]

BY39364
hg38 Position: ChrY:21411703..21411703
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below BY39361
Forward Primer: BY39364_F AACATAATTTGAAGGCTGGGC
Reverse Primer: BY39364_R GGTAGCAAATTTGGGAAAAAATAAC
Reviews

Customers who bought this product also purchased
Z16521
Z16521
BY39361
BY39361
A541
A541
FGC29280
FGC29280
BY39363
BY39363
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies