Top » Catalog » SNPs » A26547

$18.00

A26547
[A26547]

A26547
hg38 Position: ChrY:13718055..13718055
Ancestral: ins
Derived: del
Reference: Petr Soucek (2020)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A26547_F CCTAACCACAAGCTCAGAGGATC
Reverse Primer: A26547_R TAGGTAATTTGGCATTTTCCCA
Reviews

Customers who bought this product also purchased
A26549
A26549
A26548
A26548
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies