Top » Catalog » SNPs » A26549

$18.00

A26549
[A26549]

A26549
hg38 Position: ChrY:15611889..15611894
Ancestral: ins
Derived: del
Reference: Petr Soucek (2020)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A26549_F AAAGGACGTCCACACCAAAC
Reverse Primer: A26549_R CGTAACGTAGTTCTTGTGCCC
Reviews

Customers who bought this product also purchased
A26547
A26547
A26548
A26548
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies