Top » Catalog » SNPs » Y91573

$18.00

Y91573
[Y91573]

Y91573
hg38 Position: ChrY:12380221..12380221
Ancestral: G
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: E1b
Comments: V13 > Z5018 > FGC33625
Forward Primer: Y91573_F CTAAAACTTAACCTGAGAGTCTGGC
Reverse Primer: Y91573_R GGAGGAAGCAGGGCTCTAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies