$25.00

mt05 (1763 - 2426)
[mt5]

mt05 (1763 - 2426)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 1763
End Coverage: np 2426

Primers:
mt5_F: CAAATAAAGTATAGGCGATAGAAATTGA
mt5_R: TGAGCATGCCTGTGTTGGG

Reviews

Customers who bought this product also purchased
Extended HVR (15930-707)
Extended HVR (15930-707)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HVR2
1 x HVR1
$50.00
Currencies