$25.00

mt07 (3015 - 3627)
[mt7]

mt07 (3015 - 3627)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 3015
End Coverage: np 3627

Primers:
mt7_F: GGATCAGGACATCCCGATG mt7_R: GTAAACGGCTAGGCTAGAGGTG
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies