$25.00

mt08 (3555 - 4219)
[mt8]

mt08 (3555 - 4219)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 3555
End Coverage: np 4219

Primers:
mt8_F: CCTTAGCTCTCACCATCGCTC
mt8_R: GGAGATTGTAATGGGTATGGAGAC

Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HVR1
$25.00
Currencies