$25.00

mt12 (5842 - 6569)
[mt12]

mt12 (5842 - 6569)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 5842
End Coverage: np 6569

Primers:
mt12_F: GGAGCTGGTAAAAAGAGGCC
mt12_R: TCTCCTCCTCCGGCG

Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HVR1
$25.00
Currencies