$25.00

mt17 (8454 - 9168)
[mt17]

mt17 (8454 - 9168)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 8454
End Coverage: np 9168

Primers:
mt17_F: ATCACCCAACTAAAAATATTAAACACAAAC
mt17_R: CAGGTAGAGGCTTACTAGAAGTGTG

Reviews

Customers who bought this product also purchased
mt23 (12304 - 12987)
mt23 (12304 - 12987)
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HVR2
$25.00
Currencies