$25.00

mt18 (9120 - 9847)
[mt18]

mt18 (9120 - 9847)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 9120
End Coverage: np 9847

Primers:
mt18_F: CTCTACACTTATCATCTTCACAATTCTAATTC
mt18_R: GGGATGAAGCAGATAGTGAGG

Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x mtUpgrade
$115.00
Currencies