$25.00

mt20 (10416 - 11013)
[mt20]

mt20 (10416 - 11013)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 10416
End Coverage: np 11013

Primers:
mt20_F: GATTAGACTGAACCGAATTGGTATATAG
mt20_R: TTTCGTGATAGTGGTTCACTGG

Reviews

Customers who bought this product also purchased
mt11 (5547 - 6023)
mt11 (5547 - 6023)
mt10 (4858 - 5551)
mt10 (4858 - 5551)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x mtUpgrade
1 x HVR2
$134.00
Currencies