$25.00

mt29 (15899 -16569)
[mt29]

mt29 (15899 -16569)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 15899
End Coverage: np 260

Primers:
mt29_F: AAATGGGCCTGTCCTTGTAG
mt29_R: ATGTCTGTGTGGAAAGTGGC

Reviews

Customers who bought this product also purchased
Prepaid Return Envelope
Prepaid Return Envelope
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x mtUpgrade
1 x HVR2
$140.00
Currencies