Top » Catalog » SNPs » A26611

$18.00

A26611
[A26611]

A26611
hg38 Position: ChrY:2906099..2906099
Ancestral: G
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A26611_F ATGGACTTTGGAGGCTTGC
Reverse Primer: A26611_R CATTATTGTTTCTAGTAACTTTGTTCATCTATG
Reviews

Customers who bought this product also purchased
A26615
A26615
A26620
A26620
A26614
A26614
A26619
A26619
A26613
A26613
A26618
A26618
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies