Top » Catalog » SNPs » A26611

$18.00

A26611
[A26611]

A26611
hg38 Position: ChrY:2906099..2906099
Ancestral: G
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A26611_F ATGGACTTTGGAGGCTTGC
Reverse Primer: A26611_R CATTATTGTTTCTAGTAACTTTGTTCATCTATG
Reviews

Customers who bought this product also purchased
A26618
A26618
A26612
A26612
A26617
A26617
I2-Y161783 Panel
I2-Y161783 Panel
A26616
A26616
A26615
A26615
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies