Top » Catalog » SNPs » A26614

$18.00

A26614
[A26614]

A26614
hg38 Position: ChrY:13609821..13609821
Ancestral: C
Derived: G
Reference: YSEQ (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A26614_F CACCTTAAATGATTATTAAAAATTACTGAGTG
Reverse Primer: A26614_R CCAATCTCAGCTCTCTGAGTGG
Reviews

Customers who bought this product also purchased
A26618
A26618
A26611
A26611
A26617
A26617
I2-Y161783 Panel
I2-Y161783 Panel
A26616
A26616
A26615
A26615
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies