Top » Catalog » SNPs » A26614

$18.00

A26614
[A26614]

A26614
hg38 Position: ChrY:13609821..13609821
Ancestral: C
Derived: G
Reference: YSEQ (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A26614_F CACCTTAAATGATTATTAAAAATTACTGAGTG
Reverse Primer: A26614_R CCAATCTCAGCTCTCTGAGTGG
Reviews

Customers who bought this product also purchased
A26615
A26615
A26620
A26620
A26613
A26613
A26619
A26619
A26612
A26612
A26618
A26618
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies