Top » Catalog » SNPs » A26615

$18.00

A26615
[A26615]

A26615
hg38 Position: ChrY:13677069..13677069
Ancestral: A
Derived: G
Reference: YSEQ (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A26615_F CTAAAAAATTTTTGAACTGATCGACAC
Reverse Primer: A26615_R TCATTAGTGATATTGGTCTTCTTTATCC
Reviews

Customers who bought this product also purchased
A26617
A26617
I2-Y161783 Panel
I2-Y161783 Panel
A26616
A26616
A26614
A26614
A26620
A26620
A26613
A26613
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies