Top » Catalog » SNPs » A26616

$18.00

A26616
[A26616]

A26616
hg38 Position: ChrY:15314593..15314593
Ancestral: T
Derived: C
Reference: YSEQ (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A26616_F ATGAACAAGTTCTTTAGTGGTGATTTC
Reverse Primer: A26616_R GCTTTTCTTCAAAAATGTCTTCTCC
Reviews

Customers who bought this product also purchased
A26613
A26613
A26619
A26619
A26612
A26612
A26618
A26618
A26611
A26611
A26617
A26617
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies