Top » Catalog » SNPs » A26616

$18.00

A26616
[A26616]

A26616
hg38 Position: ChrY:15314593..15314593
Ancestral: T
Derived: C
Reference: YSEQ (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A26616_F ATGAACAAGTTCTTTAGTGGTGATTTC
Reverse Primer: A26616_R GCTTTTCTTCAAAAATGTCTTCTCC
Reviews

Customers who bought this product also purchased
A26611
A26611
A26617
A26617
I2-Y161783 Panel
I2-Y161783 Panel
A26615
A26615
A26614
A26614
A26620
A26620
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies