Top » Catalog » SNPs » A26620

$18.00

A26620
[A26620]

A26620
hg38 Position: ChrY:21128103..21128103
Ancestral: A
Derived: G
Reference: YSEQ (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A26620vl2_F AAAGTATTTTATTTCTCCTTCACTTATGG
Reverse Primer: A26620vl2_R GTCCCTGAACCCTGAGTCA
Reviews

Customers who bought this product also purchased
I2-Y161783 Panel
I2-Y161783 Panel
A26615
A26615
A26614
A26614
A26619
A26619
A26613
A26613
A26618
A26618
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY32561
1 x A24018
$36.00
Haplogroup Info
Other products
Currencies