Top » Catalog » SNPs » A26620

$18.00

A26620
[A26620]

A26620
hg38 Position: ChrY:21128103..21128103
Ancestral: A
Derived: G
Reference: YSEQ (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A26620vl2_F AAAGTATTTTATTTCTCCTTCACTTATGG
Reverse Primer: A26620vl2_R GTCCCTGAACCCTGAGTCA
Reviews

Customers who bought this product also purchased
A26618
A26618
A26612
A26612
A26617
A26617
A26611
A26611
A26616
A26616
I2-Y161783 Panel
I2-Y161783 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies