Top » Catalog » SNPs » A26620

$18.00

A26620
[A26620]

A26620
hg38 Position: ChrY:21128103..21128103
Ancestral: A
Derived: G
Reference: YSEQ (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A26620vl2_F AAAGTATTTTATTTCTCCTTCACTTATGG
Reverse Primer: A26620vl2_R GTCCCTGAACCCTGAGTCA
Reviews

Customers who bought this product also purchased
A26613
A26613
A26618
A26618
A26612
A26612
A26617
A26617
A26611
A26611
A26616
A26616
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies