Top » Catalog » SNPs » FGC22113

$18.00

FGC22113
[FGC22113]

FGC22113
hg38 Position: ChrY:8106383..8106383
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508 > FGC14512 > FGC17110 > YP1012
Forward Primer: FGC22113_F GTCAAAATTACTAGAATTTACCATTCTAAAAC
Reverse Primer: FGC22113_R AAGCACCTGAGCATGGTTG
Reviews

Customers who bought this product also purchased
A7628
A7628
FGC14515
FGC14515
FGC35957
FGC35957
FGC17110
FGC17110
A7627
A7627
S7660
S7660
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies