Top » Catalog » SNPs » FGC22113

$18.00

FGC22113
[FGC22113]

FGC22113
hg38 Position: ChrY:8106383..8106383
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508 > FGC14512 > FGC17110 > YP1012
Forward Primer: FGC22113_F GTCAAAATTACTAGAATTTACCATTCTAAAAC
Reverse Primer: FGC22113_R AAGCACCTGAGCATGGTTG
Reviews

Customers who bought this product also purchased
FGC22112
FGC22112
Y33772
Y33772
A7626
A7626
I1 VA-A THORNTON Family Panel v5
I1 VA-A THORNTON Family Panel v5
FGC43220
FGC43220
FGC23560
FGC23560
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2188
$18.00
Haplogroup Info
Other products
Currencies