Top » Catalog » SNPs » FGC22113

$18.00

FGC22113
[FGC22113]

FGC22113
hg38 Position: ChrY:8106383..8106383
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508 > FGC14512 > FGC17110 > YP1012
Forward Primer: FGC22113_F GTCAAAATTACTAGAATTTACCATTCTAAAAC
Reverse Primer: FGC22113_R AAGCACCTGAGCATGGTTG
Reviews

Customers who bought this product also purchased
A7627
A7627
S7660
S7660
FGC35955
FGC35955
FGC22112
FGC22112
Y33772
Y33772
A7626
A7626
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies