Top » Catalog » SNPs » FGC22115

$18.00

FGC22115
[FGC22115]

FGC22115
hg38 Position: ChrY:8530671..8530671
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508 > FGC14512 > FGC17110 > YP1012
Forward Primer: FGC22115_F ACCAAAAAACAAACATCCCTG
Reverse Primer: FGC22115_R GGAACCCATCCAATTCTCACTAC
Reviews

Customers who bought this product also purchased
FGC23549
FGC23549
FGC22110
FGC22110
FGC23559
FGC23559
FGC35959
FGC35959
FGC23548
FGC23548
FGC14507
FGC14507
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies