Top » Catalog » SNPs » FGC22115

$18.00

FGC22115
[FGC22115]

FGC22115
hg38 Position: ChrY:8530671..8530671
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508 > FGC14512 > FGC17110 > YP1012
Forward Primer: FGC22115_F ACCAAAAAACAAACATCCCTG
Reverse Primer: FGC22115_R GGAACCCATCCAATTCTCACTAC
Reviews

Customers who bought this product also purchased
FGC17110
FGC17110
A7627
A7627
S7660
S7660
FGC35955
FGC35955
FGC22112
FGC22112
Y33772
Y33772
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies