Top » Catalog » SNPs » FGC22115

$18.00

FGC22115
[FGC22115]

FGC22115
hg38 Position: ChrY:8530671..8530671
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Below P109 > S7660 > S14887 > FGC14508 > FGC14512 > FGC17110 > YP1012
Forward Primer: FGC22115_F ACCAAAAAACAAACATCCCTG
Reverse Primer: FGC22115_R GGAACCCATCCAATTCTCACTAC
Reviews

Customers who bought this product also purchased
FGC22112
FGC22112
Y33772
Y33772
A7626
A7626
I1 VA-A THORNTON Family Panel v5
I1 VA-A THORNTON Family Panel v5
FGC43220
FGC43220
FGC23560
FGC23560
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies