Top » Catalog » SNPs » CTS10228

$18.00

CTS10228
[CTS10228]

CTS10228
hg38 Position: ChrY:17222477..17222477
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a1b2a1
Comments: Downstream CTS11030
Forward Primer: CTS10228_F GGGAGCTGGAGAGGAAAGAG
Reverse Primer: CTS10228_R TGGAGTGACCCACACTCAAG
Reviews

Customers who bought this product also purchased
A7134
A7134
A10959
A10959
Y141127
Y141127
Y100616
Y100616
BY76303
BY76303
A20030
A20030
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies