Top » Catalog » SNPs » CTS10228

$18.00

CTS10228
[CTS10228]

CTS10228
hg38 Position: ChrY:17222477..17222477
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a1b2a1
Comments: Downstream CTS11030
Forward Primer: CTS10228_F GGGAGCTGGAGAGGAAAGAG
Reverse Primer: CTS10228_R TGGAGTGACCCACACTCAAG
Reviews

Customers who bought this product also purchased
BY31898
BY31898
PLE04
PLE04
A20031
A20031
PLE07
PLE07
FT14506
FT14506
BY94806
BY94806
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies