Top » Catalog » SNPs » CTS10228

$18.00

CTS10228
[CTS10228]

CTS10228
hg38 Position: ChrY:17222477..17222477
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a1b2a1
Comments: Downstream CTS11030
Forward Primer: CTS10228_F GGGAGCTGGAGAGGAAAGAG
Reverse Primer: CTS10228_R TGGAGTGACCCACACTCAAG
Reviews

Customers who bought this product also purchased
Z2582
Z2582
Y4548
Y4548
F1067
F1067
Y4486
Y4486
M217
M217
A26390
A26390
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies