Top » Catalog » SNPs » CTS10228

$18.00

CTS10228
[CTS10228]

CTS10228
hg38 Position: ChrY:17222477..17222477
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a1b2a1
Comments: Downstream CTS11030
Forward Primer: CTS10228_F GGGAGCTGGAGAGGAAAGAG
Reverse Primer: CTS10228_R TGGAGTGACCCACACTCAAG
Reviews

Customers who bought this product also purchased
MF55622
MF55622
BY114557
BY114557
L145
L145
M172
M172
Y255792
Y255792
Y12341
Y12341
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies