Top » Catalog » SNPs » CTS10228

$18.00

CTS10228
[CTS10228]

CTS10228
hg38 Position: ChrY:17222477..17222477
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a1b2a1
Comments: Downstream CTS11030
Forward Primer: CTS10228_F GGGAGCTGGAGAGGAAAGAG
Reverse Primer: CTS10228_R TGGAGTGACCCACACTCAAG
Reviews

Customers who bought this product also purchased
FT33727
FT33727
A6036
A6036
Y90421
Y90421
Y39363
Y39363
A6105
A6105
FT256413
FT256413
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies