Top » Catalog » SNPs » M3668

$18.00

M3668
[M3668]

M3668
hg38 Position: ChrY:10012964..10012964
Ancestral: C
Derived: T
Reference: Underhill et al.
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person
Forward Primer: M3668_F ATGGCTTTCCTGACTTCTGTTAC
Reverse Primer: M3668_R ATCTAATCTCAAAACCTTTTAGCTGTG
Reviews

Customers who bought this product also purchased
A169
A169
A186
A186
A174
A174
A191
A191
A162
A162
A179
A179
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies