Top » Catalog » SNPs » M3668

$18.00

M3668
[M3668]

M3668
hg38 Position: ChrY:10012964..10012964
Ancestral: C
Derived: T
Reference: Underhill et al.
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person
Forward Primer: M3668_F ATGGCTTTCCTGACTTCTGTTAC
Reverse Primer: M3668_R ATCTAATCTCAAAACCTTTTAGCTGTG
Reviews

Customers who bought this product also purchased
A172
A172
A189
A189
A177
A177
CTS2085
CTS2085
A165
A165
A183
A183
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies