Top » Catalog » SNPs » A5303

$18.00

A5303
[A5303]

A5303
hg38 Position: ChrY:12580678..12580678
Ancestral: C
Derived: G
Reference: AP (2015)
ISOGG Haplogroup: R1b1a2a1a2 (not listed)
Comments: Below Z29644 and Z29645
Forward Primer: A5303_F CAAAAGCCATAGTCTAGCTGAATG
Reverse Primer: A5303_R TGTACTGGGGCCAGTCTCTC
Reviews

Customers who bought this product also purchased
CDY
CDY
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies