Top » Catalog » SNPs » Z29644

$18.00

Z29644
[Z29644]

Z29644
hg38 Position: ChrY:13176457..13176457
Ancestral: T
Derived: C
Reference: AP (2015)
ISOGG Haplogroup: R1b1a2a1a2 (not listed)
Comments: Below P312 > ZZ37
Forward Primer: Z29644_F GGGTTTCACCCTGTTGGC
Reverse Primer: Z29644_R ACTGAAACAGTGAAAAAAGATTTGC
Reviews

Customers who bought this product also purchased
BY15482
BY15482
FGC17018
FGC17018
FGC17034
FGC17034
FGC16979
FGC16979
Y134723
Y134723
Y5049
Y5049
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies