Top » Catalog » SNPs » L2

$18.00

L2
[L2]

L2
hg38 Position: ChrY:5887509..5887509
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2b1
Comments: aka S139
Forward Primer: L2_F GTCTTCTCAATCCAGGGAGATG
Reverse Primer: L2_R GCTCACATCTCATAGAGGATCAG
Reviews

Customers who bought this product also purchased
Y3964
Y3964
A1718
A1718
FGC22968
FGC22968
FGC22942
FGC22942
Y24606
Y24606
Y20026
Y20026
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies