Top » Catalog » SNPs » L2

$18.00

L2
[L2]

L2
hg38 Position: ChrY:5887509..5887509
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2b1
Comments: aka S139
Forward Primer: L2_F GTCTTCTCAATCCAGGGAGATG
Reverse Primer: L2_R GCTCACATCTCATAGAGGATCAG
Reviews

Customers who bought this product also purchased
Y20026
Y20026
FGC22968
FGC22968
FGC22942
FGC22942
YSEQ-Alpha
YSEQ-Alpha
L513
L513
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies