Top » Catalog » SNPs » L2

$18.00

L2
[L2]

L2
HG19 Position: ChrY:5755550..5755550
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a2a1a2b1
Comments: aka S139
Forward Primer: L2_F GTCTTCTCAATCCAGGGAGATG
Reverse Primer: L2_R GCTCACATCTCATAGAGGATCAG
Reviews

Customers who bought this product also purchased
FGC20777
FGC20777
FGC20796
FGC20796
S8183
S8183
Z142
Z142
BY3604
BY3604
A15646
A15646
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies