Top » Catalog » SNPs » L2

$18.00

L2
[L2]

L2
hg38 Position: ChrY:5887509..5887509
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2b1
Comments: aka S139
Forward Primer: L2_F GTCTTCTCAATCCAGGGAGATG
Reverse Primer: L2_R GCTCACATCTCATAGAGGATCAG
Reviews

Customers who bought this product also purchased
CTS10270
CTS10270
CTS8149
CTS8149
CTS10222
CTS10222
Z67
Z67
Y19751
Y19751
CTS5531
CTS5531
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies