Top » Catalog » SNPs » L2

$18.00

L2
[L2]

L2
hg38 Position: ChrY:5887509..5887509
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2b1
Comments: aka S139
Forward Primer: L2_F GTCTTCTCAATCCAGGGAGATG
Reverse Primer: L2_R GCTCACATCTCATAGAGGATCAG
Reviews

Customers who bought this product also purchased
BY32412
BY32412
BY69713
BY69713
Z33
Z33
BY149308
BY149308
Wish a SNP
Wish a SNP
BY133159
BY133159
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies