Top » Catalog » SNPs » L2

$18.00

L2
[L2]

L2
HG19 Position: ChrY:5887509..5887509
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2b1
Comments: aka S139
Forward Primer: L2_F GTCTTCTCAATCCAGGGAGATG
Reverse Primer: L2_R GCTCACATCTCATAGAGGATCAG
Reviews

Customers who bought this product also purchased
Y17172
Y17172
CTS5531
CTS5531
PH2997
PH2997
Y17163
Y17163
A7969
A7969
S8010
S8010
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies