Top » Catalog » SNPs » Z17581

$18.00

Z17581
[Z17581]

Z17581
hg38 Position: ChrY:12492642..12492642
Ancestral: G
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of DF41 > L746
Forward Primer: Z17581_F AAGCAGAGTGCTGTTGTTGG
Reverse Primer: Z17581_R AAGGGCAGATGTTTCTCCTG
Reviews

Customers who bought this product also purchased
A749
A749
DF41
DF41
Y14197
Y14197
S781
S781
Z17582
Z17582
R1b-DF41 Panel (including Royal Stewart clades)
R1b-DF41 Panel (including Royal Stewart clades)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies