Top » Catalog » SNPs » Z17581

$18.00

Z17581
[Z17581]

Z17581
hg38 Position: ChrY:12492642..12492642
Ancestral: G
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of DF41 > L746
Forward Primer: Z17581_F AAGCAGAGTGCTGTTGTTGG
Reverse Primer: Z17581_R AAGGGCAGATGTTTCTCCTG
Reviews

Customers who bought this product also purchased
A40
A40
Y14198
Y14198
S775
S775
A749
A749
DF41
DF41
Y14197
Y14197
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies