Top » Catalog » SNPs » Z278

$18.00

Z278
[Z278]

Z278
hg38 Position: ChrY:16055599..16055599
Ancestral: A
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2a1a1a1
Comments: Below DF27 > Z296
Forward Primer: Z278_F CAATTGGGTTTGTCCATTCTC
Reverse Primer: Z278_R TTTACACGTGGCCTGATTTTC
Reviews

Customers who bought this product also purchased
A24213
A24213
FGC17318
FGC17318
Z279
Z279
R1b-DF27 Panel
R1b-DF27 Panel
Z296
Z296
CTS8087
CTS8087
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies