Top » Catalog » SNPs » Z278

$18.00

Z278
[Z278]

Z278
hg38 Position: ChrY:16055599..16055599
Ancestral: A
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2a1a1a1
Comments: Below DF27 > Z296
Forward Primer: Z278_F CAATTGGGTTTGTCCATTCTC
Reverse Primer: Z278_R TTTACACGTGGCCTGATTTTC
Reviews

Customers who bought this product also purchased
Z279
Z279
Z296
Z296
CTS8087
CTS8087
S228
S228
Z697
Z697
Z196
Z196
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies