Top » Catalog » SNPs » FGC32876

$18.00

FGC32876
[FGC32876]

FGC32876
hg38 Position: ChrY:9958527..9958527
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S1051 > FGC17906 > FGC19454
Forward Primer: FGC32876_F ATGGTCGTTCTAGTCAGGATGAG
Reverse Primer: FGC32876_R TTCCTTTATGATTTTCCTTAAACGA
Reviews

Customers who bought this product also purchased
FGC19447
FGC19447
FGC33208
FGC33208
FGC23333
FGC23333
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
FGC23338
FGC23338
FGC19446
FGC19446
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies