Top » Catalog » SNPs » FGC32879

$18.00

FGC32879
[FGC32879]

FGC32879
hg38 Position: ChrY:15301478..15301478
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC32879_F AATGGCAGTACACCCAGATGT
Reverse Primer: FGC32879_R CTGTCATAATTTTGCAAAGGCA
Reviews

Customers who bought this product also purchased
FGC19425
FGC19425
FGC23339
FGC23339
FGC19447
FGC19447
FGC33208
FGC33208
FGC23333
FGC23333
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies