Top » Catalog » SNPs » FGC32880

$18.00

FGC32880
[FGC32880]

FGC32880
hg38 Position: ChrY:15551880..15551880
Ancestral: T
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC32880_F TGAGAGACAGCAAGGCAAGG
Reverse Primer: FGC32880_R CATTAGCCTCTGAGTGAGATTGC
Reviews

Customers who bought this product also purchased
FGC23331
FGC23331
FGC33212
FGC33212
FGC23336
FGC23336
FGC19433
FGC19433
FGC31785
FGC31785
FGC23330
FGC23330
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies