Top » Catalog » SNPs » FGC32880

$18.00

FGC32880
[FGC32880]

FGC32880
hg38 Position: ChrY:15551880..15551880
Ancestral: T
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC32880_F TGAGAGACAGCAAGGCAAGG
Reverse Primer: FGC32880_R CATTAGCCTCTGAGTGAGATTGC
Reviews

Customers who bought this product also purchased
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
FGC23338
FGC23338
FGC31787
FGC31787
FGC19446
FGC19446
FGC33213
FGC33213
FGC23332
FGC23332
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies